DECIPHER (version 2.0.2)

Synteny: Synteny blocks and hits

Description

Syntenic blocks are DNA segments composed of conserved hits occurring in the same order on two sequences. The two sequences are typically chromosomes of different species that are hypothesized to contain homology. Class "Synteny" provides objects and functions for storing and viewing syntenic blocks and hits that are shared between sequences.

Usage

"pairs"(x, bounds = TRUE, boxBlocks = FALSE, labels = abbreviate(rownames(x), 9), gap = 0.5, line.main = 3, cex.labels = NULL, font.labels = 1, ...)
"plot"(x, colorBy = 1, colorRamp = colorRampPalette(c("#FCF9EE", "#FFF272", "#FFAC28", "#EC5931", "#EC354D", "#ECA6B1")), barColor = "#CCCCCC", barSides = ifelse(nrow(x) < 100, TRUE, FALSE), horizontal = TRUE, labels = abbreviate(rownames(x), 9), cex.labels = NULL, width = 0.7, ...)
"print"(x, quote = FALSE, right = TRUE, ...)

Arguments

x

An object of class ``Synteny''.

bounds

Logical specifying whether to plot sequence boundaries as horizontal or vertical lines.

boxBlocks

Logical indicating whether to draw a rectangle around hits belonging to the same block of synteny.

colorBy

Numeric giving the index of a reference sequence, or a character string indicating to color by ``neighbor'', ``frequency'', or ``none''. (See details section below.)

colorRamp

A function that will return n colors when given a number n. Examples are rainbow, heat.colors, terrain.colors, cm.colors, or (the default) colorRampPalette.

barColor

Character string giving the background color of each bar.

barSides

Logical indicating whether to draw black lines along the long-sides of each bar.

horizontal

Logical indicating whether to plot the sequences horizontally (TRUE) or vertically (FALSE).

labels

Character vector providing names corresponding to each ``identifier'' for labels on the diagonal.

width

Numeric giving the fractional width of each bar between zero and one.

gap

Distance between subplots, in margin lines.

line.main

If main is specified, line.main provides the line argument to mtext.

cex.labels

Magnification of the labels.

font.labels

Font of labels on the diagonal.

quote

Logical indicating whether to print the output surrounded by quotes.

right

Logical specifying whether to right align strings.

...

Other graphical parameters for pairs or plot, including: main, cex.main, font.main, and oma. Other arguments for print, including print.gap and max.

Details

Objects of class Synteny are stored as square matrices of list elements with dimnames giving the ``identifier'' of the corresponding sequences. The synteny matrix can be separated into three parts: along, above, and below the diagonal. Each list element along the diagonal contains an integer vector with the width of the sequence(s) belonging to that ``identifier''. List elements above the diagonal (column j > row i) each contain a matrix with ``hits'' corresponding to matches between sequences i and j. List elements below the diagonal each contain a matrix with ``blocks'' of synteny between sequences j and i.

The pairs method creates a scatterplot matrix from a Synteny object. Dot plots above the diagonal show hits between identifier i and j, where forward hits are colored in black, and hits to the reverse strand of identifier j are colored in red. Plots below the diagonal show blocks of synteny colored by their score, from green (highest scoring) to blue to magenta (lowest scoring).

The plot method displays a bar view of the sequences in the same order as the input object (x). The coloring scheme of each bar is determined by the colorBy argument, and the color palette is set by colorRamp. When colorBy is an index, the sequences are colored according to regions of shared homology with the specified reference sequence (by default 1). If colorBy is ``neighbor'' then shared syntenic blocks are connected between neighboring sequences. If colorBy is ``frequency'' then positions in each sequence are colored based on the degree of conservation with the other sequences. In each case, regions that have no correspondence in a sequence are colored barColor.

See Also

AlignSynteny, FindSynteny

Examples

# a small example:
dbConn <- dbConnect(SQLite(), ":memory:")
s1 <- DNAStringSet("ACTAGACCCAGACCGATAAACGGACTGGACAAG")
s3 <- reverseComplement(s1)
s2 <- c(s1, s3)
Seqs2DB(c(c(s1, s2), s3),
        "XStringSet",
        dbConn,
        c("s1", "s2", "s2", "s3"))
syn <- FindSynteny(dbConn, minScore=1)
syn # Note:  > 100% hits because of sequence reuse across blocks
pairs(syn, boxBlocks=TRUE)
plot(syn)
dbDisconnect(dbConn)

# a larger example:
db <- system.file("extdata", "Influenza.sqlite", package="DECIPHER")
synteny <- FindSynteny(db, minScore=50)
class(synteny) # 'Synteny'
synteny

# accessing parts
i <- 1
j <- 2
synteny[i, i][[1]] # width of sequences in i
synteny[j, j][[1]] # width of sequences in j
head(synteny[i, j][[1]]) # hits between i & j
synteny[j, i][[1]] # blocks between i & j

# plotting
pairs(synteny) # dot plots

plot(synteny) # bar view colored by position in genome 1
plot(synteny, barColor="#268FD6") # emphasize missing regions
plot(synteny, "frequency") # most regions are shared by all
plot(synteny, "neighbor")