kaks: Ka and Ks, also known as dn and ds, computation

Description

Ks and Ka are, respectively, the number of substitutions per synonymous site and per non-synonymous site between two protein-coding genes. They are also denoted as ds and dn in the literature. The ratio of nonsynonymous (Ka) to synonymous (Ks) nucleotide substitution rates is an indicator of selective pressures on genes. A ratio significantly greater than 1 indicates positive selective pressure. A ratio around 1 indicates either neutral evolution at the protein level or an averaging of sites under positive and negative selective pressures. A ratio less than 1 indicates pressures to conserve protein sequence (i.e. purifying selection). This function estimates the Ka and Ks values for a set of aligned sequences using the method published by Li (1993) and gives the associated variance matrix.

Usage

kaks(x,verbose = FALSE, debug = FALSE,  forceUpperCase = TRUE)

Arguments

An object of class alignment, obtained for instance by importing into R the data from an alignment file with the read.alignment function. This is typically a set of coding sequences alig

verbose

If TRUE add to the results the value of L0, L2, L4 (respectively the number of non-synonymous sites, of 2-fold synonymous sites, of 4-fold synonymous sites), A0, A2, A4 (respectively the number of transitional changes at non-synonymous, 2-fold, and 4-fol

debug

If TRUE turns debug mode on.

forceUpperCase

If TRUE, the default value, all character in sequences are forced to the upper case if at least one 'a', 'c', 'g', or 't' is found in the sequences. Turning it to FALSE if the sequences are already in upper case will save time.

Value

ksmatrix of Ks values
kamatrix of Ka values
vksvariance matrix of Ks
vkavariance matrix of Ka

References

Li, W.-H. (1993) Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J. Mol. Evol., 36:96-99. Hurst, L.D. (2002) The Ka/Ks ratio: diagnosing the form of sequence evolution. Trends Genet., 18:486-486. The C programm implementing this method was provided by Manolo Gouy. More info is needed here to trace back the original C source so as to credit correct source. The original FORTRAN-77 code by Chung-I Wu modified by Ken Wolfe is available here http://wolfe.gen.tcd.ie/lab/pub/li93/. For a more recent discussion about the estimation of Ka and Ks see: Tzeng, Y.H., Pan, R., Li, W.-H. (2004) Comparison of three methods for estimating rates of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol, 21:2290-2298. The method implemented here is noted LWL85 in the above paper. The cite this package in a publication, as any R package, try something as citation("seqinr") at your R prompt.

Examples

Run this code

#
 # Simple Toy example:
 #
 s <- read.alignment(file = system.file("sequences/test.phylip", package = "seqinr"),
  format = "phylip")
 kaks(s)
 #
 # Check numeric results on an simple test example:
 #
 data(AnoukResult)
 Anouk <- read.alignment(file = system.file("sequences/Anouk.fasta", package = "seqinr"),
  format = "fasta")	
## if( ! all.equal(kaks(Anouk), AnoukResult) ) {
##   warning("Poor numeric results with respect to AnoukResult standard")
## } else {
##   print("Results are consistent with AnoukResult standard")
## }
#
# As from seqinR 2.0-3 the following alignment with out-of-frame gaps
# should return a zero Ka value.
#
# >Reference
# ATGTGGTCGAGATATCGAAAGCTAGGGATATCGATTATATATAGCAAGATCGATAGAGGA
# TCGATGATCGATCGGGATCGACAGCTG
# >With out-of-frame gaps
# AT-TGGTCCAGGTATCGTAAGCTAGGGATATCGATTATATATAGCAAGATCGATAGGGGA
# TCGATGATCGATCGGGA--GACAGCTG
#
# This test example provided by Darren Obbard is now used as a routine check: 
#
 Darren <- read.alignment(file = system.file("sequences/DarrenObbard.fasta", package = "seqinr"),
  format = "fasta")
 stopifnot( all.equal(kaks(Darren)$ka[1], 0) )