Read datasets with paired-end format, possible output format of ELAND
readSeqELANDPaired(filename)The file name of the data set
Read position for each read
Chromosome of each mapped read
This format has two reads per line, each looking like "NACGATGAAACCCCGTCTCTACTAACCATACAAAAA hs_ref_chr17.fa 12091150 R TGTCGCCCAGGCTGCAATGCAGTGGCGCGATCTCGG hs_ref_chr17.fa 12091018 F". There are 8 columns, 4 for each of the paired read. The first is the actual read sequence, which we discard; the second is the chromosome of the mapped read; the third is the read position; and the last is indicating whether it is a front- or rear- end read. We only use the reads with the same mapped chromosome and only the front read. This contains more information than needed; the Chiang format is prefered.