Biostrings (version 2.40.2)

align-utils: Utility functions related to sequence alignment

Description

A variety of different functions used to deal with sequence alignments.

Usage

nedit(x) # also nmatch and nmismatch
mismatchTable(x, shiftLeft=0L, shiftRight=0L, ...)
mismatchSummary(x, ...)
"coverage"(x, shift=0L, width=NULL, weight=1L)
"coverage"(x, shift=0L, width=NULL, weight=1L)
compareStrings(pattern, subject)
"consensusMatrix"(x, as.prob=FALSE, shift=0L, width=NULL, baseOnly=FALSE, gapCode="-", endgapCode="-")

Arguments

x

A character vector or matrix, XStringSet, XStringViews, PairwiseAlignments, or list of FASTA records containing the equal-length strings.

shiftLeft, shiftRight

Non-positive and non-negative integers respectively that specify how many preceding and succeeding characters to and from the mismatch position to include in the mismatch substrings.

...

Further arguments to be passed to or from other methods.

shift, width

See ?coverage.

weight

An integer vector specifying how much each element in x counts.

pattern, subject

The strings to compare. Can be of type character, XString, XStringSet, AlignedXStringSet, or, in the case of pattern, PairwiseAlignments. If pattern is a PairwiseAlignments object, then subject must be missing.

as.prob

If TRUE then probabilities are reported, otherwise counts (the default).

baseOnly

TRUE or FALSE. If TRUE, the returned vector only contains frequencies for the letters in the "base" alphabet i.e. "A", "C", "G", "T" if x is a "DNA input", and "A", "C", "G", "U" if x is "RNA input". When x is a BString object (or an XStringViews object with a BString subject, or a BStringSet object), then the baseOnly argument is ignored.

gapCode, endgapCode

The codes in the appropriate alphabet to use for the internal and end gaps.

Details

mismatchTable: a data.frame containing the positions and substrings of the mismatches for the AlignedXStringSet or PairwiseAlignments object.

mismatchSummary: a list of data.frame objects containing counts and frequencies of the mismatches for the AlignedXStringSet or PairwiseAlignmentsSingleSubject object.

compareStrings combines two equal-length strings that are assumed to be aligned into a single character string containing that replaces mismatches with "?", insertions with "+", and deletions with "-".

See Also

pairwiseAlignment, consensusMatrix, XString-class, XStringSet-class, XStringViews-class, AlignedXStringSet-class, PairwiseAlignments-class, match-utils

Examples

  ## Compare two globally aligned strings
  string1 <- "ACTTCACCAGCTCCCTGGCGGTAAGTTGATC---AAAGG---AAACGCAAAGTTTTCAAG"
  string2 <- "GTTTCACTACTTCCTTTCGGGTAAGTAAATATATAAATATATAAAAATATAATTTTCATC"
  compareStrings(string1, string2)

  ## Create a consensus matrix
  nw1 <-
    pairwiseAlignment(AAStringSet(c("HLDNLKGTF", "HVDDMPNAL")), AAString("SMDDTEKMSMKL"),
      substitutionMatrix = "BLOSUM50", gapOpening = 3, gapExtension = 1)
  consensusMatrix(nw1)

  ## Examine the consensus between the bacteriophage phi X174 genomes
  data(phiX174Phage)
  phageConsmat <- consensusMatrix(phiX174Phage, baseOnly = TRUE)
  phageDiffs <- which(apply(phageConsmat, 2, max) < length(phiX174Phage))
  phageDiffs
  phageConsmat[,phageDiffs]