## x can be an entrez gene ID
blastSequences(17702, timeout=40, as="data.frame")
if (interactive()) {
## or x can be a sequence
blastSequences(x = "GGCCTTCATTTACCCAAAATG")
## hitListSize does not promise that you will get the number of
## matches you want.. It will just try to get that many.
blastSequences(x = "GGCCTTCATTTACCCAAAATG", hitListSize="20")
}
Run the code above in your browser using DataLab