rsbp

Provides an R interface to the Registry of Standard Biological Parts API maintained by the iGEM Foundation. Facilitates retrieval of the part number, authorship, date of entry, url, short description, type, and sequence following the Registry guidelines. All Registry content falls under Creative Commons Attribution-ShareAlike.

Users can enter the name of a part and will receive a tibble containing information about that part. Multiple parts can be accessed simultaneously using other R functions to apply getPart() over a vector containing the part names. Examples for single-part and multiple-part retrieval are provided below. The provided multi-part retrieval example requires the use of the map_df function from the purrr library.

Installation

Install the released version of rsbp from CRAN with:

install.packages("rsbp")
#> Error in install.packages : Updating loaded packages

Loading

Load the package with:

library(rsbp)

Example

For retrieval of information for single parts:

#retrieve and store information for a single part
result<-getPart("BBa_R0040")

#examine info
head(result)
#> # A tibble: 1 x 10
#>      id name    shortName seq                     type    results url             entered    desc         author               
#>   <dbl> <chr>   <chr>     <chr>                   <chr>   <chr>   <chr>           <date>     <chr>        <chr>                
#> 1   187 BBa_R0~ R0040     tccctatcagtgatagagattg~ Regula~ Works   http://parts.i~ 2003-01-31 TetR repres~ " June Rhee, Connie ~

For retrieval of information for multiple parts:

#load purrr to get map_df()
library(purrr)

#define vector of part names
parts<-c("BBa_B0034","BBa_B0035","BBa_B0036")

#apply function to each input with map_df
result<-map_df(parts, getPart)

#examine info
head(result)
#> # A tibble: 3 x 10
#>      id name    shortName seq      type  results url           entered    desc             author                              
#>   <dbl> <chr>   <chr>     <chr>    <chr> <chr>   <chr>         <date>     <chr>            <chr>                               
#> 1   151 BBa_B0~ B0034     aaagagg~ RBS   Works   http://parts~ 2003-01-31 RBS (Elowitz 19~ "Vinay S Mahajan, Voichita D. Marin~
#> 2  3978 BBa_B0~ B0035     attaaag~ RBS   Works   http://parts~ 2004-01-27 RBS (B0030 deri~ "Jason Kelly"                       
#> 3  4699 BBa_B0~ B0036     gtgtg    RBS   None    http://parts~ 2004-06-08 Specialized RBS  "Barry Canton"