Learn R Programming

triplex (version 1.12.0)

triplex-package: Triplex search and visualization package

Description

This package provides functions for the identification and visualization of potential intramolecular triplex (H-DNA) patterns in DNA sequences.

Arguments

Details

This package is essentially an R interface to the underlying C implementation of a dynamic-programming search startegy of the same name (Lexa et al., 2011). The main functionality of the original program was to detect the positions of subsequences in a much larger sequence capable of folding into an intramolecular triplex (H-DNA) made of as many cannonical nucleotide triplets as possible (see triplex.search). In creating its incarnation in R, we extended this basic functionality, to include the calculation of exact base-pairing in the triple helices, which allowed us to extend the functionality of the package towards visualization showing the exact base-pairing in 1D, 2D or 3D (see triplex.diagram and triplex.3D).

References

Lexa, M., Martinek, T., Burgetova, I., Kopecek, D., Brazdova, M.: A dynamic programming algorithm for identification of triplex-forming sequences, In: Bioinformatics, Vol. 27, No. 18, 2011, Oxford, GB, p. 2510-2517, ISSN 1367-4803

See Also

DNAString, triplex.search, triplex.diagram, triplex.3D

Examples

Run this code
seq <- DNAString("GGAAAGCAATGCCAGGCAGGG")
t <- triplex.search(seq, min_score=10, p_value=1)
triplex.diagram(t[1])
## Not run: 
# triplex.3D(t[1])
# ## End(Not run)
triplex.score.table()
triplex.group.table()

Run the code above in your browser using DataLab